ENSDARG00000034467

Ensembl ID:
ENSDARG00000034467
Human Orthologues:
AHNAK2, PRX
Human Descriptions:
AHNAK nucleoprotein 2 [Source:HGNC Symbol;Acc:20125]
periaxin [Source:HGNC Symbol;Acc:13797]
Mouse Orthologues:
Ahnak2, Prx
Mouse Descriptions:
AHNAK nucleoprotein 2 Gene [Source:MGI Symbol;Acc:MGI:2144831]
periaxin Gene [Source:MGI Symbol;Acc:MGI:108176]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13531 Essential Splice Site, Missense Available for shipment Available now
sa3866 Nonsense Mutation detected in F1 DNA During 2014
sa10978 Nonsense Available for shipment Available now
sa22215 Essential Splice Site Mutation detected in F1 DNA During 2014
sa22214 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13531
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064001 Essential Splice Site 179 1062 5 17
ENSDART00000064005 Missense 388 1272 4 18
Genomic Location:
Chromosome 13 (position 6923651)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
MTTTTCCAAATCGGACACTAAGGTCCCTGATGTTGATACAAATCTTCAAG[G/A]TACATCAGTGCAAGAAATTGAGACTGAGRTGACTGTTCCTGCTCCAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3866
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064001 None None 1062 None 17
ENSDART00000064005 Nonsense 503 1272 7 18
Genomic Location:
Chromosome 13 (position 6922916)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATTTGAAGGGTGGGGAAATTACTTTGAAGGCTGAAGAAATAGAAGCAT[C/A]GGATTTAAAAATGGACTTCGGTCTAGAGCTAAAGAAACCATCAATCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10978
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064001 Nonsense 627 1062 9 17
ENSDART00000064005 Nonsense 924 1272 12 18
Genomic Location:
Chromosome 13 (position 6920787)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGAAKTAAACCCAAGCTACCAAAAATGGGAATTAGTATGCCAAAAGTA[A/T]AGGAGATGGAACAAGAAAGTAAAGACATAAAAATAGAGACTGACCTGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22215
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064001 None None 1062 None 17
ENSDART00000064005 Essential Splice Site 1011 1272 14 18
Genomic Location:
Chromosome 13 (position 6920360)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTAGTACAGCCCACATTGACACCAAAAGCCCTGAAGTTAGCCTTCCGG[A/T]TAAGAAATTACTGTCTGGAGAAGTGTCAACCATTGACACGAAGGAACTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22214
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064001 Nonsense 954 1062 16 17
ENSDART00000064005 Nonsense 1264 1272 18 18
Genomic Location:
Chromosome 13 (position 6919167)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTTAAAATGCCAAAATTTGGAATTTCAGGTCCAAAAATATCCGATGCA[A/T]AAGCAAAACTGGGAGCAGACGTACCAGATAATGCTGACCTAAATATTGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qz26ag4a