si:ch211-163l21.7

Ensembl ID:
ENSDARG00000034457
ZFIN ID:
ZDB-GENE-081105-176
Description:
Uncharacterized protein C1orf194 homolog [Source:UniProtKB/Swiss-Prot;Acc:A8Y5T1]
Human Orthologue:
C1orf194
Human Description:
chromosome 1 open reading frame 194 [Source:HGNC Symbol;Acc:32331]
Mouse Orthologue:
1700013F07Rik
Mouse Description:
RIKEN cDNA 1700013F07 gene Gene [Source:MGI Symbol;Acc:MGI:1922754]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11524 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11524
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048623 Nonsense 63 165 2 5
ENSDART00000132657 Nonsense 62 164 2 5

The following transcripts of ENSDARG00000034457 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 24636163)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23761981
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCATAACACRACAACAGAGGCCAGTTCCCGTCGAACTGTCTTTCATTA[T/G]GATACTACAGTGAGTTGATTTAATATNGAAGGACGACTTGAACTASTTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link