igf1rb

Ensembl ID:
ENSDARG00000034434
ZFIN ID:
ZDB-GENE-020503-2
Description:
insulin-like growth factor 1b receptor [Source:RefSeq peptide;Acc:NP_694501]
Human Orthologue:
IGF1R
Human Description:
insulin-like growth factor 1 receptor [Source:HGNC Symbol;Acc:5465]
Mouse Orthologue:
Igf1r
Mouse Description:
insulin-like growth factor I receptor Gene [Source:MGI Symbol;Acc:MGI:96433]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20878 Nonsense Mutation detected in F1 DNA During 2016
sa38598 Essential Splice Site Mutation detected in F1 DNA During 2016
sa31553 Nonsense Mutation detected in F1 DNA During 2016
sa11056 Nonsense Available for shipment Available now
sa5760 Nonsense F2 line generated During 2016
sa2385 Nonsense F2 line generated During 2016

Mutation Details

Allele Name:
sa20878
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046542 Nonsense 477 1380 7 21
Genomic Location (Zv9):
Chromosome 7 (position 16325861)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 15308740
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAATGTTTCATTTTGTACTTTCTGTTTTTCTTAGGTGGGACTAAAATCT[T/A]AAAGTTTACTTCGAATAACACGAGGAGTAATCAAATCAAGCTGATGTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38598
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046542 Essential Splice Site 723 1380 10 21
Genomic Location (Zv9):
Chromosome 7 (position 16331857)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 15314736
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCGCAAAGCCTTCGAGAACTTCCTCCACAATGCCATTTTCACTCCCAG[G/A]TAAACCCTAGTTTGATCAGGAATGTGATTATTACTATTACTATATCTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31553
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046542 Nonsense 728 1380 11 21
Genomic Location (Zv9):
Chromosome 7 (position 16341434)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 15324313
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATTTCCCTAATAGATCTTAATCTCTCTGGTTTCAGACCTCCAGACAGG[C/T]GACGGAGGGATTTGTTTGGTGTGGCCAACGTAACCTCTATTCACACTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11056
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046542 Nonsense 995 1380 16 21
Genomic Location (Zv9):
Chromosome 7 (position 16351351)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 15334230
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAATGGGAAGTGGAGCGGGAGAAGATCACGATGTGCCGAGAGCTTGGA[C/T]AGGGGTCRTTTGGTATGGTGTATGAGGGCATCGCCAAAGGTGTCGTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5760
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046542 Nonsense 1357 1380 21 21
ENSDART00000046542 Nonsense 1357 1380 21 21
Genomic Location (Zv9):
Chromosome 7 (position 16371607)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 15354486
KASP Assay ID:
554-3392.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCGGCCAACGGGCCCTCCATGGTCCTGAGGGGGCCKTTTGAGGAGGGT[C/T]AGCCTTACGCTCATATGAACGGGGGCCGGAAGAACGAGCGTGCCTTGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2385
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046542 Nonsense 1357 1380 21 21
ENSDART00000046542 Nonsense 1357 1380 21 21
Genomic Location (Zv9):
Chromosome 7 (position 16371607)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 15354486
KASP Assay ID:
554-3392.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCGGCCAACGGGCCCTCCATGGTCCTGAGGGGGCCKTTTGAGGAGGGT[C/T]AGCCTTACGCTCATATGAACGGGGGCCGGAAGAACGAGCGTGCCTTGCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Arthritis (juvenile idiopathic): Genome-wide association analysis of juvenile idiopathic arthritis identifies a new susceptibility locus at chromosomal region 3q13. (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Urate levels: Genome-wide association analyses identify 18 new loci associated with serum urate concentrations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link