TRIM35 (11 of 41)

Ensembl ID:
ENSDARG00000034429
Description:
tripartite motif-containing 35 [Source:HGNC Symbol;Acc:16285]
Human Orthologue:
TRIM35
Human Description:
tripartite motif-containing 35 [Source:HGNC Symbol;Acc:16285]
Mouse Orthologue:
Trim35
Mouse Description:
tripartite motif-containing 35 Gene [Source:MGI Symbol;Acc:MGI:1914104]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5227 Nonsense Mutation detected in F1 DNA During 2014
sa8146 Nonsense Mutation detected in F1 DNA During 2014
sa5226 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5227
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104593 Nonsense 89 510 1 6
Genomic Location:
Chromosome 3 (position 50270076)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAACAAGAAATCACCTAAGAGGGAATGTCCRGTGTGCAGAAGGAAGTG[T/A]ATGCCRTCTGAGCCCACTGTGAGTTTGGCTCTAAAGAATGTGTGCGATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8146
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104593 Nonsense 108 510 1 6
Genomic Location:
Chromosome 3 (position 50270020)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RTCTGAGCCCACWGTGAGTTTGGCTCTAAAGAATGTGTGCGATGCCGTCT[T/G]ACAGGAGCAAAAAGTATCTGTTGGAGTGCCAAGCAYAGGTWCATCCAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5226
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104593 Nonsense 434 510 6 6
Genomic Location:
Chromosome 3 (position 50263612)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTATCGCTCTCTCAGATGGGCAGTACACAGCCATGACCACTCCACGAACA[C/T]AGCTCAAGCTGAATAGCCATCTAGAAAGGGTTCGGGTAAAGATTGACTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/s4sr9f9t