atp1b2b

Ensembl ID:
ENSDARG00000034424
ZFIN ID:
ZDB-GENE-010718-1
Description:
ATPase, Na+/K+ transporting, beta 2b polypeptide [Source:RefSeq peptide;Acc:NP_571913]
Human Orthologue:
ATP1B2
Human Description:
ATPase, Na+/K+ transporting, beta 2 polypeptide [Source:HGNC Symbol;Acc:805]
Mouse Orthologue:
Atp1b2
Mouse Description:
ATPase, Na+/K+ transporting, beta 2 polypeptide Gene [Source:MGI Symbol;Acc:MGI:88109]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13292 Nonsense Available for shipment Available now
sa12906 Nonsense Available for shipment Available now
sa20490 Nonsense Mutation detected in F1 DNA During 2014
sa12895 Essential Splice Site Available for shipment Available now
sa2197 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa13292
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097822 Nonsense 9 292 1 8

The following transcripts of ENSDARG00000034424 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 40107099)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGYGCACATTTAGTCCAGGAAAATGGCCAAGGATGACAAGAACGGCTG[G/A]AAGGAGTWCTTCTGGAACCCGAGGAYCCGCGAGTTCTGCGGGAGGACCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12906
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097822 Nonsense 36 292 2 8

The following transcripts of ENSDARG00000034424 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 40091397)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTTTTTTTTTTTTKTTTTTTTTTTKCAGGTCTGATTYTGCTGTTTTW[T/A]CTGGCATTCTACATATTCCTGGCTGGATTRTTTACTCTCACCATGTAYGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20490
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097822 Nonsense 77 292 3 8

The following transcripts of ENSDARG00000034424 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 40091023)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTCTCCTCCTCTCTTTTGTTTATTTGATGTTTTGCAGGGATGATGATC[A/T]GACCTAAAGGAGAGCAGCTGGAGATTGCTTATACCACCGAGTACACAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12895
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097822 Essential Splice Site 107 292 3 8

The following transcripts of ENSDARG00000034424 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 40090929)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAGAGACCTGGGAAAGATACGTGCAGGCTCTCAATAACTTCCTCTCAC[G/A]TGCGTTTATTTAACAACCCTAATGCTGCATGTATTGCACAGTAAATATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2197
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097822 Nonsense 291 292 8 8

The following transcripts of ENSDARG00000034424 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 40077236)
KASP Assay ID:
554-2491.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACGAGACAAGTTTGCTGGACGAGTTTCCTTCACACTGAGGATCAACTCC[A/T]GAGATTGAACAGACAAGAGTGTTTGTTTNTTTTTTTNGCACGCACACACAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Testosterone levels: Genome-wide association study of circulating estradiol, testosterone, and sex hormone-binding globulin in postmenopausal women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dna221oq