irx6a

Ensembl ID:
ENSDARG00000034420
ZFIN ID:
ZDB-GENE-040712-5
Description:
Iroquois homeobox protein 6aIrx6a protein [Source:UniProtKB/TrEMBL;Acc:Q503Z8]
Human Orthologue:
IRX6
Human Description:
iroquois homeobox 6 [Source:HGNC Symbol;Acc:14675]
Mouse Orthologue:
Irx6
Mouse Description:
Iroquois related homeobox 6 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1927642]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21007 Essential Splice Site Available for shipment Available now
sa1145 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21007
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045628 Essential Splice Site 16 477 2 7
Genomic Location (Zv9):
Chromosome 7 (position 36969797)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 35243640
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTGAAACGCAAATAAAAAAGTCATGTTTATCCACAATTTTCTTCATGC[A/T]GTTTTTCGTGTCGGCAACCCCCAGTACGACTTGCTGCGATTCGATATCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1145
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045628 Nonsense 225 477 4 7
Genomic Location (Zv9):
Chromosome 7 (position 36968656)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 35242499
KASP Assay ID:
554-1056.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAAAACAAGATGACTTGGTCCCCCAAAAACAAAGCAGGCGATGACAGG[A/T]AGGAAGACCTCGGTAAGAGTGACCCAGACATTACCAAAGGTACCTCATAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link