irx6a

Ensembl ID:
ENSDARG00000034420
ZFIN ID:
ZDB-GENE-040712-5
Description:
Iroquois homeobox protein 6aIrx6a protein [Source:UniProtKB/TrEMBL;Acc:Q503Z8]
Human Orthologue:
IRX6
Human Description:
iroquois homeobox 6 [Source:HGNC Symbol;Acc:14675]
Mouse Orthologue:
Irx6
Mouse Description:
Iroquois related homeobox 6 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1927642]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21007 Essential Splice Site Mutation detected in F1 DNA During 2014
sa1145 Nonsense Available for shipment Available now
sa8275 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21007
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045628 Essential Splice Site 16 477 2 7
Genomic Location:
Chromosome 7 (position 36969797)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTGAAACGCAAATAAAAAAGTCATGTTTATCCACAATTTTCTTCATGC[A/T]GTTTTTCGTGTCGGCAACCCCCAGTACGACTTGCTGCGATTCGATATCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1145
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045628 Nonsense 225 477 4 7
Genomic Location:
Chromosome 7 (position 36968656)
KASP Assay ID:
554-1056.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAAAACAAGATGACTTGGTCCCCCAAAAACAAAGCAGGCGATGACAGG[A/T]AGGAAGACCTCGGTAAGAGTGACCCAGACATTACCAAAGGTACCTCATAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa8275
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045628 Nonsense 313 477 5 7
Genomic Location:
Chromosome 7 (position 36968269)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTGGGGCCTCTGAACCCAGACTACCTAGATCATCTGGGCTCCAAACCA[C/T]AGCAGCAACAGCCCTCACCTCAGTCCACCTCCATAAACACTGTGGCACTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zjlzlv3n