pik3r3

Ensembl ID:
ENSDARG00000034409
ZFIN ID:
ZDB-GENE-040426-743
Description:
phosphatidylinositol 3-kinase regulatory subunit gamma [Source:RefSeq peptide;Acc:NP_957437]
Human Orthologue:
PIK3R3
Human Description:
phosphoinositide-3-kinase, regulatory subunit 3 (gamma) [Source:HGNC Symbol;Acc:8981]
Mouse Orthologue:
Pik3r3
Mouse Description:
phosphatidylinositol 3 kinase, regulatory subunit, polypeptide 3 (p55) Gene [Source:MGI Symbol;Acc:M

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11674 Nonsense Available for shipment Available now
sa15730 Nonsense Available for shipment Available now
sa40723 Essential Splice Site Mutation detected in F1 DNA During 2017
sa33889 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa11674
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040334 Nonsense 263 464 7 10

The following transcripts of ENSDARG00000034409 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 33248020)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 33565685
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTATCTAAGGGTTTTTCAATTGATCTTTCTCAGGATTATGATGAACTAC[G/T]AGAAGCTTAAATCCCGTCTGGGTGAAATTCACGACAGTAAGACCCGGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15730
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040334 Nonsense 314 464 7 10

The following transcripts of ENSDARG00000034409 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 33248175)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 33565840
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACAGCTTAAAGCCAGATCTMATTCAGCTCCGAAAGATTAGAGAWCAGTA[C/A]CTTGTGTAAGCAAAASCATCCTTCACACACCATTCCAWGTCAKCATTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40723
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040334 Essential Splice Site 316 464 7 10
ENSDART00000040334 Essential Splice Site 316 464 7 10

The following transcripts of ENSDARG00000034409 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 33248182)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 33565847
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAAGCCAGATCTCATTCAGCTCCGAAAGATTAGAGATCAGTACCTTGTG[T/G]AAGCAAAACCATCCTTCACACACCATTCCAAGTCATCATTACTGTTATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33889
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040334 Essential Splice Site 316 464 7 10
ENSDART00000040334 Essential Splice Site 316 464 7 10

The following transcripts of ENSDARG00000034409 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 33248182)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 33565847
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAAGCCAGATCTCATTCAGCTCCGAAAGATTAGAGATCAGTACCTTGTG[T/G]AAGCAAAACCATCCTTCACACACCATTCCAAGTCATCATTACTGTTATGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link