mars

Ensembl ID:
ENSDARG00000034396
ZFIN ID:
ZDB-GENE-030219-83
Description:
methionyl-tRNA synthetase, cytoplasmic [Source:RefSeq peptide;Acc:NP_956370]
Human Orthologue:
MARS
Human Description:
methionyl-tRNA synthetase [Source:HGNC Symbol;Acc:6898]
Mouse Orthologue:
Mars
Mouse Description:
methionine-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:1345633]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7590 Missense Mutation detected in F1 DNA During 2014
sa5394 Nonsense Mutation detected in F1 DNA During 2014
sa16933 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa7590
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049574 Missense 495 922 12 22
ENSDART00000074544 Missense 495 913 12 21
ENSDART00000144514 Missense 524 942 12 21
ENSDART00000144911 Missense 524 951 12 22
Genomic Location:
Chromosome 6 (position 58851579)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCACTCGCTCCTGGCTGCGGGACGGTCTGAAGCCGCGCTGCATCACAC[G/A]TGACTTRAAGTGGGGGACGCCGGTGCCGCACCCCGACTACAAGGAGAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5394
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049574 Nonsense 678 922 16 22
ENSDART00000074544 Nonsense 678 913 16 21
ENSDART00000144514 Nonsense 707 942 16 21
ENSDART00000144911 Nonsense 707 951 16 22
Genomic Location:
Chromosome 6 (position 58841904)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTTTTCGAMGGTTGTGTTCCTGAGATGCTGCTGAATGACGACGATAAG[C/T]GRCTCATCGCTCAGGTCTGCTGGGAGCTCAAGCAGTACATCCAGCTGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16933
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049574 Essential Splice Site 822 922 19 22
ENSDART00000074544 Essential Splice Site 822 913 19 21
ENSDART00000144514 Essential Splice Site 851 942 19 21
ENSDART00000144911 Essential Splice Site 851 951 19 22
Genomic Location:
Chromosome 6 (position 58833973)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGAAYGAGCAGATCGAGGCTCTGAGGAAGAGATTCGGAGGACTGCAGG[T/C]TTGTAAAGACGTGCATTATTAAYCAGGGCCACAAGAAGRAAATCTGATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/07dnw99o