jmjd6

Ensembl ID:
ENSDARG00000034358
ZFIN IDs:
ZDB-GENE-040426-17, ZDB-GENE-040426-17
Description:
Bifunctional arginine demethylase and lysyl-hydroxylase JMJD6 [Source:UniProtKB/Swiss-Prot;Acc:Q6PFM
Human Orthologue:
JMJD6
Human Description:
jumonji domain containing 6 [Source:HGNC Symbol;Acc:19355]
Mouse Orthologue:
Jmjd6
Mouse Description:
jumonji domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:1858910]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33340 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33340
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012113 Essential Splice Site 269 403 3 8
ENSDART00000125169 Essential Splice Site 269 403 3 9
Genomic Location (Zv9):
Chromosome 3 (position 61200011)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 60504259
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCCGCTGGAGATCCTGCAGCGCCCTGGAGAGACCGTGTTCGTGCCCGG[T/G]CAGTCGCATGCTCCTCTAAATGTGCTCTAAATTCGATATTTCAATGCAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link