pcdh19

Ensembl ID:
ENSDARG00000034344
ZFIN ID:
ZDB-GENE-030131-4218
Description:
protocadherin 19 [Source:RefSeq peptide;Acc:NP_001120991]
Human Orthologue:
PCDH19
Human Description:
protocadherin 19 [Source:HGNC Symbol;Acc:14270]
Mouse Orthologue:
Pcdh19
Mouse Description:
protocadherin 19 Gene [Source:MGI Symbol;Acc:MGI:2685563]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35743 Nonsense Mutation detected in F1 DNA During 2017
sa22531 Nonsense Available for shipment Available now
sa30984 Nonsense Mutation detected in F1 DNA During 2017
sa35742 Essential Splice Site Mutation detected in F1 DNA During 2017
sa22530 Essential Splice Site Available for shipment Available now
sa12445 Nonsense Available for shipment Available now
sa952 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa35743
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125788 Nonsense 314 1088 1 5
Genomic Location (Zv9):
Chromosome 14 (position 41692684)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 40020762
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTAATCACAGTGAACGGCGTTTTGGACCACGAGGAACTGCACATTCAC[G/T]AAATTGACGTACAAGCCAAAGATCTGGGTCCAAATTCAATCCCTGCCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22531
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125788 Nonsense 439 1088 1 5
Genomic Location (Zv9):
Chromosome 14 (position 41692308)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 40020386
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCATTCTGGCCGAGGACAGCGGGTATCCCCCGCTCAGAAGCTCGAAAT[C/A]GTTTGCGGTGAAAGTAACAGATGAAAACGACAATCCCCCGTACTTCACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30984
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125788 Nonsense 459 1088 1 5
Genomic Location (Zv9):
Chromosome 14 (position 41692247)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 40020325
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGTAACAGATGAAAACGACAATCCCCCGTACTTCACCAAGCCCCATTA[T/A]CAAGCCATGGTGCTCGAAAATAACGTCCCAGGTGCGTTTCTTCTGGCGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35742
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125788 Essential Splice Site 716 1088 1 5
Genomic Location (Zv9):
Chromosome 14 (position 41691476)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 40019554
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGTCAAGTGCAAAAGGGATAACAAGGAAATCAGAACCTACAACTGCAG[G/A]TACCCAGACAATTTATATACCTCTTTTTAGCCTAGTTCAGCGTGCGAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22530
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125788 Essential Splice Site 845 1088 3 5
Genomic Location (Zv9):
Chromosome 14 (position 41648251)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 39976329
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTCCATTGACTCCAGTTATGTAAACAGCAGAGCACACCTAATTAAAAG[G/A]TACGTCTTAATAGACCAATCAGATTAACTTATCTTATTCAACTTGATGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12445
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125788 Nonsense 857 1088 4 5
Genomic Location (Zv9):
Chromosome 14 (position 41643361)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 39971439
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCACCTGGCTGTAGCACGTCAAYATTCAAGGACATGGAAGGAARCAGTT[T/A]GAAGGACAGCGGGCACGAAGAGAGCGACCAAACAGACAGTGAACATGACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa952
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125788 Nonsense 1070 1088 5 5
Genomic Location (Zv9):
Chromosome 14 (position 41609162)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 39937240
KASP Assay ID:
554-0857.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGAGGGGAAGGACAGTGAGCCGGCCATGCGGGAGATCAACACGCTCCTA[C/T]AGGACGGYCGTGATAAAGAGTCCCCCGGCAGCAAGAGACTGAAGGACATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link