ing3

Ensembl ID:
ENSDARG00000034326
ZFIN ID:
ZDB-GENE-040109-3
Description:
inhibitor of growth protein 3 [Source:RefSeq peptide;Acc:NP_957231]
Human Orthologue:
ING3
Human Description:
inhibitor of growth family, member 3 [Source:HGNC Symbol;Acc:14587]
Mouse Orthologue:
Ing3
Mouse Description:
inhibitor of growth family, member 3 Gene [Source:MGI Symbol;Acc:MGI:1919027]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1532 Nonsense F2 line generated During 2016
sa16070 Essential Splice Site Available for shipment Available now
sa6930 Nonsense Confirmed mutation in F2 line During 2016
sa18549 Nonsense Available for shipment Available now
sa40231 Nonsense Mutation detected in F1 DNA During 2016
sa15341 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1532
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037140 Nonsense 70 416 4 12
ENSDART00000122636 Nonsense 70 416 4 13

The following transcripts of ENSDARG00000034326 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 9670940)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10607567
KASP Assay ID:
554-1456.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGATAATATGCTTTCCTAATRATCTCTTTCTGTTTACCAGGACTACTA[T/G]AAAGCTTTAGAAGATGCGGATGAAAAGGTCCAATTAGCCAATCAAATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16070
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037140 Essential Splice Site 239 416 8 12
ENSDART00000122636 Essential Splice Site 239 416 8 13

The following transcripts of ENSDARG00000034326 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 9673485)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10610112
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGTGCTATTTCCATGGCAGCAGCTCAGGCAGTGCAAGCCACAGCACAGG[T/A]AAACCGCCTAGTTTTACAYTACACYTAATTTCCTGTTCAAACTATTTTKG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6930
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037140 Nonsense 250 416 9 12
ENSDART00000122636 Nonsense 250 416 9 13

The following transcripts of ENSDARG00000034326 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 9675497)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10612124
KASP Assay ID:
554-4542.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAYACTGTGTGTGTTTCAGATGAAAGAGGGCAGGAGAACATCCAGTCTC[A/T]AGGCCAGTTATGAAGCGGTCAAGAACAATGATTTCTTGGGWCGAGATTTT
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
swim bladder
ZFA:0000076
aplastic
PATO:0001483
abnormal
PATO:0000460

Mutation Details

Allele Name:
sa18549
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037140 Nonsense 253 416 9 12
ENSDART00000122636 Nonsense 253 416 9 13

The following transcripts of ENSDARG00000034326 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 9675508)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10612135
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RTGTTTCAGATGAAAGAGGGCAGGAGAACATCCAGTCTCWAGGCCAGTTA[T/A]GAAGCGGTCAAGAACAATGAWTTCTTGGGWCGAGATTTTACYATGAGTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40231
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037140 Nonsense 262 416 9 12
ENSDART00000122636 Nonsense 262 416 9 13

The following transcripts of ENSDARG00000034326 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 9675534)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10612161
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACATCCAGTCTCAAGGCCAGTTATGAAGCGGTCAAGAACAATGATTTCT[T/A]GGGTCGAGATTTTACCATGAGTCGAGACTCCAGCAGTTACTCGTCTTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15341
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037140 Essential Splice Site 378 416 None 12
ENSDART00000122636 Essential Splice Site 378 416 None 13

The following transcripts of ENSDARG00000034326 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 9676611)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10613238
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YTTTGTGCAGGTGTCKTACGGAGAGATGGTCGGCTGTGATAACCAAGAWG[T/A]AAGTCAACCCTTCATCTTTAGGGACACACACAGACAACATTTCCTCTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link