palmd

Ensembl ID:
ENSDARG00000034321
ZFIN ID:
ZDB-GENE-090713-3
Human Orthologue:
PALMD
Human Description:
palmdelphin [Source:HGNC Symbol;Acc:15846]
Mouse Orthologue:
Palmd
Mouse Description:
palmdelphin Gene [Source:MGI Symbol;Acc:MGI:2148896]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24523 Nonsense Available for shipment Available now
sa9748 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24523
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046091 Nonsense 29 445 2 7
ENSDART00000109985 Nonsense 32 404 2 9
ENSDART00000127994 Nonsense 29 448 2 7
ENSDART00000135094 Nonsense 47 144 3 5

The following transcripts of ENSDARG00000034321 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 30862946)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 29971507
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTTATCAGGACAAAAGAAGAATTCGAGAGGAAATAGAAAAGAAACGA[A/T]GAAGCATTGAAGAAGAGAAATTAAACCTACAATATCTAAAGGTAAACGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9748
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046091   None 445 None 7
ENSDART00000109985   None 404 None 9
ENSDART00000127994 Essential Splice Site 125 448 None 7
ENSDART00000135094   None 144 None 5

The following transcripts of ENSDARG00000034321 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 30850488)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 29959049
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTMAATTGGATCYGCTTTTGAGTTGGAACAAGRGAAATCATTAGAATTC[A/T]GCATGCTGTGAAGATGGYCCTCGGTTCCAAACTGACGTCAAGAKAAAAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link