chrne

Ensembl ID:
ENSDARG00000034307
ZFIN ID:
ZDB-GENE-040808-32
Description:
acetylcholine receptor subunit gamma [Source:RefSeq peptide;Acc:NP_001003772]
Human Orthologue:
CHRNE
Human Description:
cholinergic receptor, nicotinic, epsilon [Source:HGNC Symbol;Acc:1966]
Mouse Orthologue:
Chrne
Mouse Description:
cholinergic receptor, nicotinic, epsilon polypeptide Gene [Source:MGI Symbol;Acc:MGI:87894]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18813 Nonsense Available for shipment Available now
sa15968 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18813
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112487 Nonsense 187 329 6 10
ENSDART00000136428 Nonsense 187 517 6 12
Genomic Location:
Chromosome 5 (position 40046329)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGCAGGTCTCAGACATACAGTGCAAATGAGATTGATATTGTACTGGCA[G/T]AAGATGAGAACGGAAAGCCTATTGAGTGGGTGGACATTGATCCTGAGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15968
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112487 Essential Splice Site 311 329 8 10
ENSDART00000136428 Essential Splice Site 311 517 8 12
Genomic Location:
Chromosome 5 (position 40044011)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTCTCAGAAAATACCAGAAACGTCACTGTCTGTGCCTCTTATTGGCAA[G/A]TCAGTACCAGTTTTCTCTCTCGACAGTTTCKATTTTTTATCCTTGAATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/84beknfd