sema3c

Ensembl ID:
ENSDARG00000034300
ZFIN ID:
ZDB-GENE-050513-5
Description:
Novel protein similar to vertebrate semaphorin 3C (SEMA3C) [Source:UniProtKB/TrEMBL;Acc:Q5RGH9]
Human Orthologue:
SEMA3C
Human Description:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C [Source:HGNC
Mouse Orthologue:
Sema3c
Mouse Description:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C Gene [Source:

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30849 Nonsense Mutation detected in F1 DNA During 2017
sa15161 Nonsense Available for shipment Available now
sa12671 Nonsense Available for shipment Available now
sa1359 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30849
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002104 Nonsense 36 757 1 17
ENSDART00000131161   None 713 None 16
Genomic Location (Zv9):
Chromosome 4 (position 21517464)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 22860799
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTTCTCCTCGGCCTCAGCGTCTCCAGCATTCATGCTCTTTCTTCTCCA[C/T]AGCCGCGAGTCTTCCTGCCATTTCAAGGTAAGAATGGTTAATGTCATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15161
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002104 Nonsense 186 757 5 17
ENSDART00000131161 Nonsense 142 713 4 16
Genomic Location (Zv9):
Chromosome 4 (position 21562341)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 22905676
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAATCAGGGAAAGGGYGCTGCTCCTTCAACCCACAAGTCAACACTGTCT[C/A]GGTCATGCTCMGTGAGTCTTTTATGTCTTTATCCACAGGTGCCAATTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12671
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002104 Nonsense 422 757 11 17
ENSDART00000131161 Nonsense 378 713 10 16
Genomic Location (Zv9):
Chromosome 4 (position 21573411)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 22916746
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGTGGTGACGTTTGTGAGGAATCACCCTGTCATGTTTAACCCCATCTA[C/A]CCTGTGGGAAGGAAACCCCTGGTGGWGCGAACGCATGCCGACTACAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1359
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002104 Nonsense 439 757 11 17
ENSDART00000131161 Nonsense 395 713 10 16
Genomic Location (Zv9):
Chromosome 4 (position 21573462)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 22916797
KASP Assay ID:
554-1272.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGTGGGAAGGAAACCCCTGGTGGTGCGAACGCATGCCGACTACAAATA[C/A]ACCTCTATAGCGGTGGATCAGGTCCCAGCAGCAGACGGCCACTACCAGGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link