hif1ab

Ensembl ID:
ENSDARG00000034293
ZFIN ID:
ZDB-GENE-040426-706
Description:
hypoxia-inducible factor 1-alpha [Source:RefSeq peptide;Acc:NP_956527]
Human Orthologue:
HIF1A
Human Description:
hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) [Source:HGNC
Mouse Orthologue:
Hif1a
Mouse Description:
hypoxia inducible factor 1, alpha subunit Gene [Source:MGI Symbol;Acc:MGI:106918]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16125 Nonsense Available for shipment Available now
sa23673 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa16125
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018500 Nonsense 137 777 4 15
ENSDART00000047580 Nonsense 137 532 4 15
Genomic Location:
Chromosome 20 (position 20410476)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTTCTCTCTCTTAGTTTGATCTGACCGGKCACAGCATCTTTGAATTTT[C/A]ACACCCATGTGACCATGAAGAGTTGAGAGAGATGCTCGTCCACAGAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23673
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018500 Essential Splice Site 504 777 10 15
ENSDART00000047580 None None 532 None 15
Genomic Location:
Chromosome 20 (position 20404069)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCAGACCCCACAAACACACCCTCCACATCTGGACTCGGCTCTTCGGGGG[T/C]AAACACTTATTAAACGCTTGCTATTCTTGGTCATTTAACAACAATTGCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6jixbvkp