ogdh

Ensembl ID:
ENSDARG00000034270
ZFIN ID:
ZDB-GENE-030131-2143
Description:
oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) [Source:RefSeq peptide;Acc:NP_957073]
Human Orthologue:
OGDH
Human Description:
oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) [Source:HGNC Symbol;Acc:8124]
Mouse Orthologue:
Ogdh
Mouse Description:
oxoglutarate dehydrogenase (lipoamide) Gene [Source:MGI Symbol;Acc:MGI:1098267]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34482 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31676 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa34482
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022242 Essential Splice Site 312 1024 6 22
ENSDART00000046064   None 175 None 3
ENSDART00000132965   None 230 None 5
ENSDART00000148206 Essential Splice Site 312 1022 7 23
Genomic Location (Zv9):
Chromosome 8 (position 47943162)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 45781420
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCCAGTGAGAACGGCGTAGACACTGTCATCATGGGCATGCCTCACAGG[T/C]ACAGGACAAGATGCAGCGATAGAGATAGAAAGGATAGATAGAAGGAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31676
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022242 Essential Splice Site 556 1024 11 22
ENSDART00000046064   None 175 None 3
ENSDART00000132965   None 230 None 5
ENSDART00000148206 Essential Splice Site 556 1022 12 23
Genomic Location (Zv9):
Chromosome 8 (position 47940138)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 45778396
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGCTGAGAAGCTCATTGCTGAAGGTGCCGTTACGCGACAGGAGTATGAG[G/A]TCCGTCAGCCAGAGATAATTTAGCTGCCTTTTATCCTCAGCTGGACCTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link