odz4

Ensembl ID:
ENSDARG00000034264
ZFIN ID:
ZDB-GENE-990714-20
Description:
Teneurin-4 [Source:UniProtKB/Swiss-Prot;Acc:Q9W7R3]
Human Orthologue:
ODZ4
Human Description:
odz, odd Oz/ten-m homolog 4 (Drosophila) [Source:HGNC Symbol;Acc:29945]
Mouse Orthologue:
Odz4
Mouse Description:
odd Oz/ten-m homolog 4 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2447063]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39035 Essential Splice Site Mutation detected in F1 DNA During 2016
sa42497 Essential Splice Site Mutation detected in F1 DNA During 2016
sa10710 Nonsense Available for shipment Available now
sa22594 Nonsense Available for shipment Available now
sa12130 Nonsense Available for shipment Available now
sa42498 Nonsense Mutation detected in F1 DNA During 2016
sa35813 Nonsense Mutation detected in F1 DNA During 2016
sa24976 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa39035
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002791 Essential Splice Site 457 2849 7 30
ENSDART00000045312 Essential Splice Site 432 2824 6 29
ENSDART00000146828   None 2193 None 21
Genomic Location (Zv9):
Chromosome 15 (position 10761784)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 10307187
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCATCCTCATCTCTGTCACCCTGGTGTTCCTGTTGGCATACTTTATTG[G/A]TAAGTTCAGTTTTTGCCAGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42497
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002791 Essential Splice Site 584 2849 9 30
ENSDART00000045312 Essential Splice Site 559 2824 8 29
ENSDART00000146828   None 2193 None 21
Genomic Location (Zv9):
Chromosome 15 (position 10784131)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 10284840
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGGTGGGGATCTACGGGAGGAGAGGACTGCCACCGTCACACACACAGG[T/G]CAGTTTTTATTCGTTTAAAGGGATAGGTCACACAAATTTTCATTTACTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10710
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002791 Nonsense 846 2849 14 30
ENSDART00000045312 Nonsense 821 2824 13 29
ENSDART00000146828 Nonsense 190 2193 4 21
Genomic Location (Zv9):
Chromosome 15 (position 10833891)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 10235080
KASP Assay ID:
2260-8179.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTGGAMATGGCATCTGTGTRGCGGGCAGCTGCCGGTGCGACGAGGGCT[G/A]GATGGGCACCGGGTGYGAGCAACGGGCTTGTCACCCTCGCYGCAGCGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22594
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002791 Nonsense 1326 2849 21 30
ENSDART00000045312 Nonsense 1301 2824 20 29
ENSDART00000146828 Nonsense 670 2193 11 21
Genomic Location (Zv9):
Chromosome 15 (position 10889992)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 10178979
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGGCGGATGGAAACAAGCTGCTCGCACCTGTAGCTTTAGCTTGCGGGT[C/A]GGATGGCAGTCTGTATGTGGGAGATTTCAACTACGTCCGTCGCATCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12130
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002791 Nonsense 1989 2849 27 30
ENSDART00000045312 Nonsense 1964 2824 26 29
ENSDART00000146828 Nonsense 1333 2193 17 21
Genomic Location (Zv9):
Chromosome 15 (position 10964140)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 10104831
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATTGCTGGCATCCAGAGRGGCACAATGTCAGTCCGAATGGAATATGAC[C/T]AAAATGGGAGAATCACCTCAAAGATATTTGCAGATGGAAAATCATGGWGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42498
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002791 Nonsense 2003 2849 27 30
ENSDART00000045312 Nonsense 1978 2824 26 29
ENSDART00000146828 Nonsense 1347 2193 17 21
Genomic Location (Zv9):
Chromosome 15 (position 10964183)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 10104788
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATGACCAAAATGGGAGAATCACCTCAAAGATATTTGCAGATGGAAAAT[C/A]ATGGAGCTACACCTACCTTGAAAAGGTATGCACCTTTGACTGTAAAGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35813
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002791 Nonsense 2391 2849 28 30
ENSDART00000045312 Nonsense 2366 2824 27 29
ENSDART00000146828 Nonsense 1735 2193 18 21
Genomic Location (Zv9):
Chromosome 15 (position 10966117)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 10102854
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGCTTGGGCAGAAGAGTGTCCAGTCGAAGTACCCAAGGCCACCATCTG[C/T]AATTCTTCTATGCAGACTTGTCCAGTCCCACCAGAGTCACACACATGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24976
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002791 Nonsense 2470 2849 28 30
ENSDART00000045312 Nonsense 2445 2824 27 29
ENSDART00000146828 Nonsense 1814 2193 18 21
Genomic Location (Zv9):
Chromosome 15 (position 10966355)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 10102616
KASP Assay ID:
554-7451.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTCTCATGATCAAACAGATTCTCCACACAGCTTTTGGGGAAGTATATT[T/A]AGACTCCAACCCAAGCTTCCAGCTAGTAATAGGCTACCAGGGCGGCCTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link