capza1a

Ensembl ID:
ENSDARG00000034240
ZFIN ID:
ZDB-GENE-030131-5237
Description:
F-actin capping protein alpha-1 subunit [Source:RefSeq peptide;Acc:NP_997862]
Human Orthologue:
CAPZA1
Human Description:
capping protein (actin filament) muscle Z-line, alpha 1 [Source:HGNC Symbol;Acc:1488]
Mouse Orthologues:
4933400A11Rik, Capza1
Mouse Descriptions:
capping protein (actin filament) muscle Z-line, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:106227]
RIKEN cDNA 4933400A11 gene Gene [Source:MGI Symbol;Acc:MGI:1913997]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33958 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33958
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046973 Essential Splice Site 220 286 8 9
Genomic Location (Zv9):
Chromosome 6 (position 48265601)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 48326151
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTGAGTTTCCTACTCATGTATAAATTCTGTTTGCTCTTATTTTTCAAC[A/G]GACTGAGGTACAGACTGCCAAGGAGTTTGTCGAGATCATTAAAAACGCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Blood pressure: Meta-analysis of genome-wide association studies identifies common variants associated with blood pressure variation in east Asians. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link