KIAA0753

Ensembl ID:
ENSDARG00000034227
Description:
KIAA0753 [Source:HGNC Symbol;Acc:29110]
Human Orthologue:
KIAA0753
Human Description:
KIAA0753 [Source:HGNC Symbol;Acc:29110]
Mouse Orthologue:
4933427D14Rik
Mouse Description:
RIKEN cDNA 4933427D14 gene Gene [Source:MGI Symbol;Acc:MGI:1921727]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22657 Nonsense Available for shipment Available now
sa10312 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22657
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042521 Nonsense 323 895 5 25
Genomic Location:
Chromosome 15 (position 26219861)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACTCAGATGCTTGACTCAGCTCTGAGCAAGCAGGAGACCACCAAAAAA[C/T]GAGATGTGTATTTGCAGAATGTTAACCCAGTGGAAAAGACCTCCATTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10312
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042521 Essential Splice Site 362 895 7 25
Genomic Location:
Chromosome 15 (position 26219149)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTTATAATTAATCATAGCACTTTTATGTAGTTTATTGGCCATTTTACA[T/A]GAAATTAAGCAAACCACCTTTTTATAATTWATGATTACCTTTTATTTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jlszoynk