KIAA0753

Ensembl ID:
ENSDARG00000034227
Description:
KIAA0753 [Source:HGNC Symbol;Acc:29110]
Human Orthologue:
KIAA0753
Human Description:
KIAA0753 [Source:HGNC Symbol;Acc:29110]
Mouse Orthologue:
4933427D14Rik
Mouse Description:
RIKEN cDNA 4933427D14 gene Gene [Source:MGI Symbol;Acc:MGI:1921727]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35898 Nonsense Mutation detected in F1 DNA During 2016
sa22657 Nonsense Available for shipment Available now
sa28465 Nonsense Mutation detected in F1 DNA During 2016
sa10312 Essential Splice Site Available for shipment Available now
sa35897 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa35898
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042521 Nonsense 4 895 1 25
Genomic Location (Zv9):
Chromosome 15 (position 26221706)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 26953073
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATATTAATAAATCAGCCTCTCTTTCATTCTCATCTTGTTATCACAGCTT[C/T]AGTTCAATAGTGCAGTGTTACCCAGTGTCCTGAACCGAGCCACCCGAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22657
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042521 Nonsense 323 895 5 25
Genomic Location (Zv9):
Chromosome 15 (position 26219861)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 26951228
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACTCAGATGCTTGACTCAGCTCTGAGCAAGCAGGAGACCACCAAAAAA[C/T]GAGATGTGTATTTGCAGAATGTTAACCCAGTGGAAAAGACCTCCATTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28465
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042521 Nonsense 327 895 5 25
Genomic Location (Zv9):
Chromosome 15 (position 26219848)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 26951215
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACTCAGCTCTGAGCAAGCAGGAGACCACCAAAAAACGAGATGTGTATT[T/A]GCAGAATGTTAACCCAGTGGAAAAGACCTCCATTCAGGTCAGGGCCCGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10312
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042521 Essential Splice Site 362 895 7 25
Genomic Location (Zv9):
Chromosome 15 (position 26219149)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 26950516
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTTATAATTAATCATAGCACTTTTATGTAGTTTATTGGCCATTTTACA[T/A]GAAATTAAGCAAACCACCTTTTTATAATTWATGATTACCTTTTATTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35897
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042521 Nonsense 524 895 11 25
Genomic Location (Zv9):
Chromosome 15 (position 26216182)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 26947549
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCCAGATGTCTGTTCTCACCTCATAAAAACCCTGAAAAGCAGAAGCCG[C/T]AGACTACATCCAGTACCCAGCTCAGTGCTTCATCACCTGACAGGAAACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link