KIAA0753

Ensembl ID:
ENSDARG00000034227
Description:
KIAA0753 [Source:HGNC Symbol;Acc:29110]
Human Orthologue:
KIAA0753
Human Description:
KIAA0753 [Source:HGNC Symbol;Acc:29110]
Mouse Orthologue:
4933427D14Rik
Mouse Description:
RIKEN cDNA 4933427D14 gene Gene [Source:MGI Symbol;Acc:MGI:1921727]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22657 Nonsense Available for shipment Available now
sa28465 Nonsense Mutation detected in F1 DNA During 2015
sa10312 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22657
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042521 Nonsense 323 895 5 25
Genomic Location:
Chromosome 15 (position 26219861)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACTCAGATGCTTGACTCAGCTCTGAGCAAGCAGGAGACCACCAAAAAA[C/T]GAGATGTGTATTTGCAGAATGTTAACCCAGTGGAAAAGACCTCCATTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28465
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042521 Nonsense 327 895 5 25
Genomic Location:
Chromosome 15 (position 26219848)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACTCAGCTCTGAGCAAGCAGGAGACCACCAAAAAACGAGATGTGTATT[T/A]GCAGAATGTTAACCCAGTGGAAAAGACCTCCATTCAGGTCAGGGCCCGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10312
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042521 Essential Splice Site 362 895 7 25
Genomic Location:
Chromosome 15 (position 26219149)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTTATAATTAATCATAGCACTTTTATGTAGTTTATTGGCCATTTTACA[T/A]GAAATTAAGCAAACCACCTTTTTATAATTWATGATTACCTTTTATTTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jlszoynk