capn2l

Ensembl ID:
ENSDARG00000034211
ZFIN ID:
ZDB-GENE-050417-341
Description:
calpain-2 catalytic subunit [Source:RefSeq peptide;Acc:NP_001017807]
Human Orthologue:
CAPN2
Human Description:
calpain 2, (m/II) large subunit [Source:HGNC Symbol;Acc:1479]
Mouse Orthologue:
Capn2
Mouse Description:
calpain 2 Gene [Source:MGI Symbol;Acc:MGI:88264]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12826 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12826
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083351 Essential Splice Site 523 700 14 21
Genomic Location:
Chromosome 22 (position 27185872)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATACTGTATTATTACACAAAAATGCTTKATTTTGATTTTTATTCTTGT[A/T]GATTGAGATAAAAGAGGSAGATATCGATAGCCGGTTCAGGAATCTGTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9norcviz