top2b

Ensembl ID:
ENSDARG00000034195
ZFIN ID:
ZDB-GENE-041008-136
Description:
DNA topoisomerase 2-beta [Source:RefSeq peptide;Acc:NP_001038656]
Human Orthologue:
TOP2B
Human Description:
topoisomerase (DNA) II beta 180kDa [Source:HGNC Symbol;Acc:11990]
Mouse Orthologue:
Top2b
Mouse Description:
topoisomerase (DNA) II beta Gene [Source:MGI Symbol;Acc:MGI:98791]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11711 Nonsense Available for shipment Available now
sa23498 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11711
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029024 Nonsense 343 1613 9 35
ENSDART00000130695 Nonsense 348 1618 9 35
Genomic Location:
Chromosome 19 (position 19721914)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGWACTCATGAGCTTTGTGATATTTTAGGGAGGAAGACATAKCGATTA[T/A]ATAGTGGACCAAATAGTGGGGAAATTGATTGAAGTTGTGAAGAAGAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23498
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029024 Nonsense 401 1613 10 35
ENSDART00000130695 Nonsense 406 1618 10 35
Genomic Location:
Chromosome 19 (position 19721588)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAACCCAACCTTTGATTCTCAGACCAAGGAGAACATGACTCTACAGACC[A/T]AAAGCTTCGGTTCCAAATGTGCTCTCTCGGAGAAATTCATCAGAGCTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/p9x56goo