esr2b

Ensembl ID:
ENSDARG00000034181
ZFIN ID:
ZDB-GENE-030116-1
Description:
estrogen receptor 2b [Source:RefSeq peptide;Acc:NP_777287]
Human Orthologue:
ESR2
Human Description:
estrogen receptor 2 (ER beta) [Source:HGNC Symbol;Acc:3468]
Mouse Orthologue:
Esr2
Mouse Description:
estrogen receptor 2 (beta) Gene [Source:MGI Symbol;Acc:MGI:109392]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa77 Essential Splice Site Confirmed mutation in F2 line During 2014

Mutation Details

Allele Name:
sa77
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041300 None 234 600 4 10
ENSDART00000063412 Essential Splice Site 234 592 3 9
ENSDART00000131800 Essential Splice Site 234 592 4 10

The following transcripts of ENSDARG00000034181 do not overlap with this mutation:

Genomic Location:
Chromosome 13 (position 37449975)
KASP Assay ID:
554-0023.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGCCTGTCGACTCCGCAAGTGCTATGAAGTGGGCATGATGAAGTGTGG[T/C]ATGCAGCTGACTCTCCGCTTCTGTGTGTAGCCACATACTGTATTTATATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/udo1ruj5