cpsf1

Ensembl ID:
ENSDARG00000034178
ZFIN ID:
ZDB-GENE-040709-2
Description:
cleavage and polyadenylation specificity factor subunit 1 [Source:RefSeq peptide;Acc:NP_001108153]
Human Orthologue:
CPSF1
Human Description:
cleavage and polyadenylation specific factor 1, 160kDa [Source:HGNC Symbol;Acc:2324]
Mouse Orthologue:
Cpsf1
Mouse Description:
cleavage and polyadenylation specific factor 1 Gene [Source:MGI Symbol;Acc:MGI:2679722]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23476 Essential Splice Site Mutation detected in F1 DNA During 2014
sa16124 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23476
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024861 None None 985 None 24
ENSDART00000045987 Essential Splice Site 180 416 6 12
ENSDART00000110017 Essential Splice Site 180 1451 5 37
ENSDART00000110513 None None 400 None 15
Genomic Location:
Chromosome 19 (position 12567461)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGGAAGGACACGCTTGCTGACGAACAGGAGGGGATTGTGGGAGAGGGG[T/C]GAGAATAAATGTTTTCTAAATACTTGAAGACATTTCTTTTTTATTATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16124
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024861 Essential Splice Site 436 985 10 24
ENSDART00000045987 None None 416 None 12
ENSDART00000110017 Essential Splice Site 902 1451 23 37
ENSDART00000110513 None None 400 None 15
Genomic Location:
Chromosome 19 (position 12541088)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTACGACCAGCARCAAGCTCARAGCAAYCTGAAAGTGCGCTTCAAGAAGG[T/C]ACARGCTGTATCAATAYTTACTCTCCTCAGGAWGTTTACTGTAATGGTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ankz59s9