mrrf

Ensembl ID:
ENSDARG00000034174
ZFIN ID:
ZDB-GENE-040704-12
Description:
ribosome-recycling factor, mitochondrial [Source:RefSeq peptide;Acc:NP_001002174]
Human Orthologues:
MRRF, MRRFP1
Human Descriptions:
mitochondrial ribosome recycling factor pseudogene 1 [Source:HGNC Symbol;Acc:35238]
mitochondrial ribosome recycling factor [Source:HGNC Symbol;Acc:7234]
Mouse Orthologue:
Mrrf
Mouse Description:
mitochondrial ribosome recycling factor Gene [Source:MGI Symbol;Acc:MGI:1915121]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21672 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21672
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039536 Essential Splice Site 109 257 5 8
Genomic Location:
Chromosome 10 (position 9411874)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTGCAGCGAATCCTGTTGGCTAACAAAAGATTTTGTTCTTATGTGTTC[A/T]GGTGCACTGGACCACATTACAGTCACCACAAAGGATGGCAAATTTCCTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/r14lb5mo