prkcq

Ensembl ID:
ENSDARG00000034173
ZFIN ID:
ZDB-GENE-041210-195
Description:
protein kinase C, theta [Source:RefSeq peptide;Acc:NP_001082839]
Human Orthologue:
PRKCQ
Human Description:
protein kinase C, theta [Source:HGNC Symbol;Acc:9410]
Mouse Orthologue:
Prkcq
Mouse Description:
protein kinase C, theta Gene [Source:MGI Symbol;Acc:MGI:97601]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7269 Essential Splice Site Mutation detected in F1 DNA During 2017
sa20289 Nonsense Available for shipment Available now
sa2170 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa7269
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046253 Essential Splice Site 39 721 2 17
ENSDART00000123680   None 709 None 17
Genomic Location (Zv9):
Chromosome 4 (position 24502308)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25425977
KASP Assay ID:
554-5178.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAGTGTTTTTCTGTTCAGCCAGTRAAACTTACTGCAGAATTTATCTTAT[A/T]TATTTGTGTGCATCTCTAGAAAAGGGTCAAGTGTACAAACAGAAGCGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20289
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046253 Nonsense 494 721 12 17
ENSDART00000123680 Nonsense 482 709 12 17
Genomic Location (Zv9):
Chromosome 4 (position 24521126)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25444795
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGCGACTTAATGTTCCACATCCAGACCTGTCACAGATTTGACCTCCCA[C/T]GATCCACGTGAGCTACATACAGCCCCCACACACAGATTTTTAAAGGCCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2170
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046253 Essential Splice Site 626 721 15 17
ENSDART00000123680 Essential Splice Site 614 709 15 17
Genomic Location (Zv9):
Chromosome 4 (position 24525508)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25449177
KASP Assay ID:
554-3308.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTTACCCACGCTGGTTAACTAGAGATGCACGAGACATTCTTGTGAAGG[T/A]ATATCTGAACTAGAGATCAATATAAGACTTGYGATTCTGTTATGAACTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link