ccnk

Ensembl ID:
ENSDARG00000034146
ZFIN ID:
ZDB-GENE-030131-5126
Description:
cyclin K [Source:RefSeq peptide;Acc:NP_001157251]
Human Orthologue:
CCNK
Human Description:
cyclin K [Source:HGNC Symbol;Acc:1596]
Mouse Orthologue:
Ccnk
Mouse Description:
cyclin K Gene [Source:MGI Symbol;Acc:MGI:1276106]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36956 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36956
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048204 Nonsense 50 424 2 13
ENSDART00000104581 Nonsense 50 425 2 12
ENSDART00000142518 Nonsense 50 526 2 11
Genomic Location (Zv9):
Chromosome 20 (position 5117096)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 5032463
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCACACCCCGTCCCAGTCAGACCTGGACCCAGCCACAGAAGCGCGGTA[C/A]AGACGAGAGGGAGCCAGGTTCATCTTCGATGTCGGAACACGTTTGGGATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link