rarga

Ensembl ID:
ENSDARG00000034117
ZFIN ID:
ZDB-GENE-980526-531
Description:
Retinoic acid receptor gamma-A [Source:UniProtKB/Swiss-Prot;Acc:Q91392]
Human Orthologue:
RARG
Human Description:
retinoic acid receptor, gamma [Source:HGNC Symbol;Acc:9866]
Mouse Orthologue:
Rarg
Mouse Description:
retinoic acid receptor, gamma Gene [Source:MGI Symbol;Acc:MGI:97858]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32460 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32460
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049551 Nonsense 151 499 4 8
ENSDART00000103158 Nonsense 159 507 4 8
ENSDART00000129222   None 153 None 4
ENSDART00000143935   None 153 None 4
Genomic Location (Zv9):
Chromosome 23 (position 36010753)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 35860406
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGAGTATTGAGCAGCCTCTCTTTGTGACTTTCAGCTGTGCGCAACGAT[C/T]GAAATAAGAAGAAGAAAGACGTGAAGGATGAGGTCATTCCGCCAGAGAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link