LOC557250

Ensembl ID:
ENSDARG00000034105
Human Orthologue:
MTUS1
Human Description:
microtubule associated tumor suppressor 1 [Source:HGNC Symbol;Acc:29789]
Mouse Orthologue:
Mtus1
Mouse Description:
mitochondrial tumor suppressor 1 Gene [Source:MGI Symbol;Acc:MGI:2142572]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32636 Nonsense Mutation detected in F1 DNA During 2016
sa30582 Nonsense Mutation detected in F1 DNA During 2016
sa12425 Nonsense Available for shipment Available now
sa25552 Nonsense Mutation detected in F1 DNA During 2016
sa6577 Essential Splice Site Mutation detected in F1 DNA During 2016
sa1312 Essential Splice Site Available for shipment Available now
sa1993 Essential Splice Site F2 line generated During 2016
sa19459 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32636
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048855 Nonsense 36 1416 1 14
Genomic Location (Zv9):
Chromosome 1 (position 15282671)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 15847839
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCACCTCCTGCGCTTCCCAACAGACCTCAGCATGAATTGTGTCTCCCGT[T/G]ACGCAGTAATGAGCACAATAACATTGCGTTCAACTCTGAGTCTTCCTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30582
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048855 Nonsense 232 1416 1 14
Genomic Location (Zv9):
Chromosome 1 (position 15283259)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 15848427
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAGACACATCTGAGGACCTACAATCGGATGTGTCTAAAGGGTGTTTGT[T/A]GAATGAAACCAACAGGGAAGTTGTCAACGAAAAAGGGGAAGTCTCTTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12425
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048855 Nonsense 248 1416 1 14
Genomic Location (Zv9):
Chromosome 1 (position 15283307)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 15848475
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGAATRAAACCAACAGGGAAGTTGTCWACGAAAAAGGGGAARTCTCTT[T/A]AGCCATTCAAGAAAYTGATGTTGTGAATGAGAYATTTGCGTCACCTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25552
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048855 Nonsense 467 1416 1 14
Genomic Location (Zv9):
Chromosome 1 (position 15283964)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 15849132
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATGCAGCTTCTTCTCTCTTAAAAGAGGAGTACCAGCCAAAACCCATGT[T/A]GAAAATGGCTGCTGGGAATAAATCCAATAGGAAAATTGGCCACAAAAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6577
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048855 Essential Splice Site 1090 1416 6 14
Genomic Location (Zv9):
Chromosome 1 (position 15332550)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 15897718
KASP Assay ID:
554-4418.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGGCGTCTGGAGGCTCTCGCTCTGGTCGTGCAGCACATCTTCAGTGAGG[T/C]TGGAGAGCTTTATTRTTTCTTTCTTTCTAGATACTCCTCTGTGGAGTTTW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1312
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048855 Essential Splice Site 1113 1416 7 14
Genomic Location (Zv9):
Chromosome 1 (position 15346044)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 15911212
KASP Assay ID:
554-1227.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAGGGAAGAACTTTCTGTCCAAATCAACAACCTGCGAGAGCAACTGAG[T/C]AAGTAACACATGTCCAGTCAATTACACAGAGACTCGGTTCTTGTGTCCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1993
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048855 Essential Splice Site 1220 1416 9 14
Genomic Location (Zv9):
Chromosome 1 (position 15354131)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 15919299
KASP Assay ID:
554-3080.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGAGCAAATAGCAACACTGAAACATGAACATGAGACTTCACTCACAGG[T/C]GATTTCACTGCAGTSATCRACAGTTTCTGCTTTTGTTTAATGTACTGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19459
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048855 Nonsense 1282 1416 12 14
Genomic Location (Zv9):
Chromosome 1 (position 15355773)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 15920941
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTCAAACTAAGCAGCTGTTTCTCTGTGTGCAGAAGGACGCGCATACAT[T/A]GTATTTGGAGCAAGAACTGGAGAGTCTCAGAGCTGTGCTGGAAATAAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link