LOC557250

Ensembl ID:
ENSDARG00000034105
Human Orthologue:
MTUS1
Human Description:
microtubule associated tumor suppressor 1 [Source:HGNC Symbol;Acc:29789]
Mouse Orthologue:
Mtus1
Mouse Description:
mitochondrial tumor suppressor 1 Gene [Source:MGI Symbol;Acc:MGI:2142572]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12425 Nonsense Available for shipment Available now
sa4836 Nonsense Mutation detected in F1 DNA During 2014
sa6577 Essential Splice Site Mutation detected in F1 DNA During 2014
sa1312 Essential Splice Site Available for shipment Available now
sa1993 Essential Splice Site F2 line generated During 2014
sa2019 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19459 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12425
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048855 Nonsense 248 1416 1 14
Genomic Location:
Chromosome 1 (position 15283307)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGAATRAAACCAACAGGGAAGTTGTCWACGAAAAAGGGGAARTCTCTT[T/A]AGCCATTCAAGAAAYTGATGTTGTGAATGAGAYATTTGCGTCACCTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4836
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048855 Nonsense 592 1416 1 14
Genomic Location:
Chromosome 1 (position 15284339)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCSAGAGGATAATARCATAACGRGTACCAAAAATGCAGCTTCTTCCCTCT[T/G]AAAAGAGAGCAACCAGCCAAAACCCAAAGACCAACCAGAAAACGTGTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6577
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048855 Essential Splice Site 1090 1416 6 14
Genomic Location:
Chromosome 1 (position 15332550)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGGCGTCTGGAGGCTCTCGCTCTGGTCGTGCAGCACATCTTCAGTGAGG[T/C]TGGAGAGCTTTATTRTTTCTTTCTTTCTAGATACTCCTCTGTGGAGTTTW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1312
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048855 Essential Splice Site 1113 1416 7 14
Genomic Location:
Chromosome 1 (position 15346044)
KASP Assay ID:
554-1227.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAGGGAAGAACTTTCTGTCCAAATCAACAACCTGCGAGAGCAACTGAG[T/C]AAGTAACACATGTCCAGTCAATTACACAGAGACTCGGTTCTTGTGTCCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1993
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048855 Essential Splice Site 1220 1416 9 14
Genomic Location:
Chromosome 1 (position 15354131)
KASP Assay ID:
554-3080.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGAGCAAATAGCAACACTGAAACATGAACATGAGACTTCACTCACAGG[T/C]GATTTCACTGCAGTSATCRACAGTTTCTGCTTTTGTTTAATGTACTGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2019
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048855 Essential Splice Site 1244 1416 10 14
Genomic Location:
Chromosome 1 (position 15354317)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGCAAGAACTTGACAAAACGCTYAAGGAGTCTGAGGCCATGCTTAATG[T/C]ATGCATCACCATCTCATCATTTCCCTTACTGTTTAACTTGGAATATTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19459
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048855 Nonsense 1282 1416 12 14
Genomic Location:
Chromosome 1 (position 15355773)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTCAAACTAAGCAGCTGTTTCTCTGTGTGCAGAAGGACGCGCATACAT[T/A]GTATTTGGAGCAAGAACTGGAGAGTCTCAGAGCTGTGCTGGAAATAAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6xfi70jr