dclk2

Ensembl ID:
ENSDARG00000034093
ZFIN ID:
ZDB-GENE-050420-170
Description:
serine/threonine-protein kinase DCLK2 isoform 2 [Source:RefSeq peptide;Acc:NP_001139259]
Human Orthologue:
DCLK2
Human Description:
doublecortin-like kinase 2 [Source:HGNC Symbol;Acc:19002]
Mouse Orthologue:
Dclk2
Mouse Description:
doublecortin-like kinase 2 Gene [Source:MGI Symbol;Acc:MGI:1918012]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13063 Essential Splice Site Available for shipment Available now
sa25622 Essential Splice Site Mutation detected in F1 DNA During 2017
sa39646 Essential Splice Site Mutation detected in F1 DNA During 2017
sa7382 Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa13063
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008756 Essential Splice Site 247 713 None 16
ENSDART00000043855 Essential Splice Site 247 810 None 17
ENSDART00000045111 Essential Splice Site 247 791 None 16
ENSDART00000078206 Essential Splice Site 247 700 None 16
ENSDART00000136996 Essential Splice Site 247 688 None 15
ENSDART00000140036 Essential Splice Site 247 700 None 16
ENSDART00000145698 Essential Splice Site 247 716 None 16

The following transcripts of ENSDARG00000034093 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 37095489)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 36526027
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACAGTGTTTCTCCTTTTGTCTCTTCCCCCACCCCTTCCTCTCTCTGTCC[A/C]GATTATATGTTTGCAGGATTWCTTTGGAGATGATGACRTTTTCATCGCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25622
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008756 Essential Splice Site 456 713 9 16
ENSDART00000043855 Essential Splice Site 459 810 9 17
ENSDART00000045111 Essential Splice Site 440 791 8 16
ENSDART00000078206 Essential Splice Site 440 700 8 16
ENSDART00000136996 Essential Splice Site 431 688 8 15
ENSDART00000140036 Essential Splice Site 440 700 8 16
ENSDART00000145698 Essential Splice Site 459 716 9 16

The following transcripts of ENSDARG00000034093 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 37129627)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 36560165
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGGAGTTTGCACTGAAGATCATCGATAAAAACAAATGCAGAGGCAAAG[T/A]GAGTTTTTTTTCCCAATAATTAATAAAGGTCAAATTCAGAAAATGCCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39646
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008756 Essential Splice Site 496 713 10 16
ENSDART00000043855 Essential Splice Site 499 810 10 17
ENSDART00000045111 Essential Splice Site 480 791 9 16
ENSDART00000078206 Essential Splice Site 480 700 9 16
ENSDART00000136996 Essential Splice Site 471 688 9 15
ENSDART00000140036 Essential Splice Site 480 700 9 16
ENSDART00000145698 Essential Splice Site 499 716 10 16

The following transcripts of ENSDARG00000034093 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 37132140)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 36562678
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGGTGGATACGCCTGCTGAGCTCTATCTGGTCATGGAACTTGTGAAGG[T/A]AATGTTTGTCTGTCACCTCTTATAATGTAAGCACACACACAAACACATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7382
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008756 Missense 526 713 11 16
ENSDART00000043855 Missense 529 810 11 17
ENSDART00000045111 Missense 510 791 10 16
ENSDART00000078206 Missense 510 700 10 16
ENSDART00000136996 Missense 501 688 10 15
ENSDART00000140036 Missense 510 700 10 16
ENSDART00000145698 Missense 529 716 11 16

The following transcripts of ENSDARG00000034093 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 37132627)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 36563165
KASP Assay ID:
554-4198.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATACACWGAAAAAGATGCCAGCGTGATGGTGTTTGACCTGGCAGCAGCTC[T/A]CAAATATCTACACAGAAWGTGCATCGTTCATCGAGACATCAAACCTGAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link