plcd1b

Ensembl ID:
ENSDARG00000034080
ZFIN ID:
ZDB-GENE-030131-9435
Description:
phospholipase C, delta 1b [Source:RefSeq peptide;Acc:NP_956362]
Human Orthologue:
PLCD1
Human Description:
phospholipase C, delta 1 [Source:HGNC Symbol;Acc:9060]
Mouse Orthologue:
Plcd1
Mouse Description:
phospholipase C, delta 1 Gene [Source:MGI Symbol;Acc:MGI:97614]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38324 Nonsense Mutation detected in F1 DNA During 2017
sa13963 Nonsense Available for shipment Available now
sa32897 Essential Splice Site Mutation detected in F1 DNA During 2017
e52 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38324
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046098 Nonsense 77 749 3 15
ENSDART00000142174 Nonsense 100 282 3 5
ENSDART00000144587 Nonsense 77 259 3 5

The following transcripts of ENSDARG00000034080 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 21217802)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21763217
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTCCCTCAGTCTCTATTGAGGACATTGAGGAAGTCCGAACAGGTCGA[C/T]AAACAGACAGTCTGAGGAAATACACAGAGGAGACATTGGAGGGTCGAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13963
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046098 Nonsense 89 749 3 15
ENSDART00000142174   112 282 3 5
ENSDART00000144587   89 259 3 5

The following transcripts of ENSDARG00000034080 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 21217765)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21763180
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGAACAGGTCGACAAACAGACAGTCTGAGGAAATACACAGAGGAGACAT[T/A]GGAGGGTCGAGCGTTCTCCATCTTGTTTAAGGGTCGTCAGAAAAGCCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32897
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046098 Essential Splice Site 183 749 4 15
ENSDART00000142174 Essential Splice Site 206 282 4 5
ENSDART00000144587 Essential Splice Site 183 259 4 5

The following transcripts of ENSDARG00000034080 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 21217403)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21762818
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACATCAACGTTGAAGTGCACGAAGACTACGCTGAAATGCTCTTTAAGG[T/G]GATATGGGAATTTGATCATCTGTAATGTTTTCACACCGTGTCCTAACTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
e52
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046098 Nonsense 301 749 6 15
ENSDART00000142174   None 282 None 5
ENSDART00000144587   None 259 None 5

The following transcripts of ENSDARG00000034080 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 21210083)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21755853
KASP Assay ID:
554-0031.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGCTCATAAAAGTGTTTACCATGACATGAACCAGCCTCTCAGCCATTA[C/A]TTCATCTCCTCCTCTCACAACACATACCTGATGGAGGACCAGCTCAAAGG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link