im:7145112

Ensembl ID:
ENSDARG00000034060
ZFIN IDs:
ZDB-GENE-041111-227, ZDB-GENE-041111-227
Description:
Im:7145112 protein [Source:UniProtKB/TrEMBL;Acc:Q6DG69]
Human Orthologue:
ELAC2
Human Description:
elaC homolog 2 (E. coli) [Source:HGNC Symbol;Acc:14198]
Mouse Orthologue:
Elac2
Mouse Description:
elaC homolog 2 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:1890496]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13936 Nonsense Available for shipment Available now
sa9564 Essential Splice Site Available for shipment Available now
sa11507 Essential Splice Site Available for shipment Available now
sa3456 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13936
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048095 Nonsense 217 865 7 25
ENSDART00000122518 Nonsense 173 821 6 24
Genomic Location:
Chromosome 3 (position 11477135)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCMGSCCTTACACTGAGCCTCAGTATAAAGACGAAACCATGACCGTCAGC[C/T]AGATTCCTCTMTTCTGTGAGTCTCACCGTAGTTTTACAGCATTCTCAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9564
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048095 Essential Splice Site 367 865 12 25
ENSDART00000122518 Essential Splice Site 323 821 11 24
Genomic Location:
Chromosome 3 (position 11470811)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTCAGAGGACTTCATAARGCCGCTCWGCTCCAATCMYATCTTGAAAAGG[T/G]CAGCTGTGGTCCAATGTTGAGCAATTTCAGGATGAGCTTCAAAACAGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11507
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048095 Essential Splice Site 718 865 23 25
ENSDART00000122518 Essential Splice Site 674 821 22 24
Genomic Location:
Chromosome 3 (position 11449773)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTGTGKGNNAGGCGAGGAGAGAGTTTGATTCATCTTTTGGTTTGTTCTC[A/T]GGCAAAAACGCAACTCTTTTGATTCATGAAGCCACGCTGGAGGACGGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3456
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048095 Essential Splice Site 744 865 24 25
ENSDART00000122518 Essential Splice Site 700 821 23 24
Genomic Location:
Chromosome 3 (position 11440454)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCAGACRACAACAATTTATYCTAGAGGTCTGACTGTGAAACTCTCTGCA[G/A]CACCACGTCTCAGGCTATCGGCATCGGGATGAAGATGAATGCTGGATTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/twyvtlou