csnk1g2b

Ensembl ID:
ENSDARG00000034056
ZFIN ID:
ZDB-GENE-060825-285
Description:
casein kinase 1, gamma 2b [Source:RefSeq peptide;Acc:NP_001039315]
Human Orthologue:
CSNK1G2
Human Description:
casein kinase 1, gamma 2 [Source:HGNC Symbol;Acc:2455]
Mouse Orthologue:
Csnk1g2
Mouse Description:
casein kinase 1, gamma 2 Gene [Source:MGI Symbol;Acc:MGI:1920014]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1660 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1660
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021683 Nonsense 293 410 8 11
ENSDART00000100328 Nonsense 293 444 7 11
ENSDART00000138794 None None 55 None 2
Genomic Location:
Chromosome 8 (position 21084126)
KASP Assay ID:
554-1607.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTTTGCACACTGCAGAGGAGATGGCCACTTATCTGAGATATGTTCGA[C/T]GACTGGACTTCTTYGAGAGACCGGATTACGAATACTTAAGGAAGCTCTTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/u7w5ncl7