irx5a

Ensembl ID:
ENSDARG00000034043
ZFIN ID:
ZDB-GENE-010716-2
Description:
iroquois-class homeodomain protein IRX-5 [Source:RefSeq peptide;Acc:NP_001038692]
Human Orthologue:
IRX5
Human Description:
iroquois homeobox 5 [Source:HGNC Symbol;Acc:14361]
Mouse Orthologue:
Irx5
Mouse Description:
Iroquois related homeobox 5 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1859086]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17095 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17095
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043857 Nonsense 435 446 3 3
Genomic Location (Zv9):
Chromosome 7 (position 37161785)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 35435628
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGAGAGCAAAGTAAGAAGCCAAACACAGGTAGATCTTTGTAAAGACT[C/A]ACCTTATGAGCTAAAGAAAGGTATGTYAAACATTTAATACCGGATTCATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link