prom1b

Ensembl ID:
ENSDARG00000034007
ZFIN ID:
ZDB-GENE-031003-1
Description:
prominin 1 b [Source:RefSeq peptide;Acc:NP_932337]
Human Orthologue:
PROM1
Human Description:
prominin 1 [Source:HGNC Symbol;Acc:9454]
Mouse Orthologue:
Prom1
Mouse Description:
prominin 1 Gene [Source:MGI Symbol;Acc:MGI:1100886]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13905 Nonsense Available for shipment Available now
sa32663 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa13905
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045368 Nonsense 13 853 1 25
ENSDART00000102768 Nonsense 13 851 1 26
ENSDART00000134719 Nonsense 15 853 1 26
ENSDART00000134831   None 182 None 7
ENSDART00000140920   None 124 None 6
Genomic Location (Zv9):
Chromosome 1 (position 21530954)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22066121
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACTGATGGACATGWGGTGGAAAGTGGGRCTCGTGCTGGTGATKTTTTG[G/A]GGTCTCACAAGCAGCGAAGACCGCGAGGAGCACCGGGAGTCCCCGCCGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32663
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045368 Essential Splice Site 451 853 None 25
ENSDART00000102768 Essential Splice Site 449 851 None 26
ENSDART00000134719 Essential Splice Site 451 853 None 26
ENSDART00000134831   None 182 None 7
ENSDART00000140920   None 124 None 6
Genomic Location (Zv9):
Chromosome 1 (position 21504394)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22039561
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAATATTGAAGCATACTATCCACAGATCGACCAGCTGGACTTCTACAGG[T/C]ACTTCTGCAGAGTTCACCAATATAAAACTAACACCATACACACACTACAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link