cyp26a1

Ensembl ID:
ENSDARG00000033999
ZFIN ID:
ZDB-GENE-990415-44
Description:
Cytochrome P450 26A1 [Source:UniProtKB/Swiss-Prot;Acc:P79739]
Human Orthologue:
CYP26A1
Human Description:
cytochrome P450, family 26, subfamily A, polypeptide 1 [Source:HGNC Symbol;Acc:2603]
Mouse Orthologue:
Cyp26a1
Mouse Description:
cytochrome P450, family 26, subfamily a, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:1096359]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1738 Nonsense Available for shipment Available now
sa3831 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa1738
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041728 Nonsense 218 492 3 7

The following transcripts of ENSDARG00000033999 do not overlap with this mutation:

Genomic Location:
Chromosome 12 (position 9711087)
KASP Assay ID:
554-1683.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACGGACGAGCAAGAACTGGTGGAAGCTTTTGAGGAAATGATCAAAAACT[T/A]GTTCTCCTTGCCAATCGAYGTTCCTTTCAGTGGTCTGTACAGGGTGAGTT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa3831
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041728 Nonsense 264 492 4 7

The following transcripts of ENSDARG00000033999 do not overlap with this mutation:

Genomic Location:
Chromosome 12 (position 9710865)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATCAGGAAGAAAATTCAAGATGACGACAATGAAAACGAGCAGAAATAC[A/T]AAGACGCTCTTCAGCTGTTGATCGAGAACAGCAGAAGAAGTGACGAACCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Refractive error: Genome-wide meta-analyses of multiancestry cohorts identify multiple new susceptibility loci for refractive error and myopia. (View Study)
  • Triglycerides: Biological, clinical and population relevance of 95 loci for blood lipids. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7ppagw5p