LOC100334831

Ensembl ID:
ENSDARG00000033993
Human Orthologue:
SLC19A1
Human Description:
solute carrier family 19 (folate transporter), member 1 [Source:HGNC Symbol;Acc:10937]
Mouse Orthologue:
Slc19a1
Mouse Description:
solute carrier family 19 (sodium/hydrogen exchanger), member 1 Gene [Source:MGI Symbol;Acc:MGI:10318

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40675 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40675
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049465 Essential Splice Site 463 528 5 5
Genomic Location (Zv9):
Chromosome 6 (position 22353856)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 18609393
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATATTTAGCTATTTTGTTCTAATATGATTTTGTTTTTCCTCTCTCTTGC[A/G]GTTTTTTGTTTATTTCTTTTACTTCACCCTGCTGACTGTGATTTATCTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link