nxn

Ensembl ID:
ENSDARG00000033978
ZFIN ID:
ZDB-GENE-050522-75
Description:
Nucleoredoxin [Source:UniProtKB/Swiss-Prot;Acc:Q503L9]
Human Orthologue:
NXN
Human Description:
nucleoredoxin [Source:HGNC Symbol;Acc:18008]
Mouse Orthologue:
Nxn
Mouse Description:
nucleoredoxin Gene [Source:MGI Symbol;Acc:MGI:109331]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16536 Nonsense Available for shipment Available now
sa35837 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa16536
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028500 Nonsense 91 418 1 8
ENSDART00000133580   None 315 None 7
Genomic Location (Zv9):
Chromosome 15 (position 15342220)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 16387183
KASP Assay ID:
2260-8259.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCTTCGGATCAGGACCAGAAACAGTGGCAGGACTTCTTGCAGGAGATG[C/T]AATGGCCGGCGTTGCCTTTTAAAGACAGACACAAAAAGGTAAGATGATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35837
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028500 Nonsense 229 418 5 8
ENSDART00000133580 Nonsense 126 315 4 7
Genomic Location (Zv9):
Chromosome 15 (position 15236001)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 16280964
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGTAGCGATGTGTTGTTCTTCAGGTCGGAGGAGTCGTTTACTCAGTA[T/A]TTCAGCGAGATGCCATGGTTAGCTGTGCCGTACTCAGACGAGGCCAGACG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link