prrx1a

Ensembl ID:
ENSDARG00000033971
ZFIN ID:
ZDB-GENE-020905-5
Description:
paired related homeobox 1a [Source:RefSeq peptide;Acc:NP_999899]
Human Orthologue:
PRRX1
Human Description:
paired related homeobox 1 [Source:HGNC Symbol;Acc:9142]
Mouse Orthologue:
Prrx1
Mouse Description:
paired related homeobox 1 Gene [Source:MGI Symbol;Acc:MGI:97712]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19740 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19740
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041365 Nonsense 109 245 2 4
Genomic Location (Zv9):
Chromosome 2 (position 22626953)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 23513658
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGCGTAAACAGAGGCGAAACAGAACCACGTTCAACAGCAGTCAGCTG[C/T]AGGCCTTAGAGAGAGTGTTTGAGAGGACGCATTACCCCGATGCTTTCGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link