nupl1

Ensembl ID:
ENSDARG00000033965
ZFIN ID:
ZDB-GENE-040426-2326
Description:
nucleoporin p58/p45 [Source:RefSeq peptide;Acc:NP_998394]
Human Orthologue:
NUPL1
Human Description:
nucleoporin like 1 [Source:HGNC Symbol;Acc:20261]
Mouse Orthologue:
Nupl1
Mouse Description:
nucleoporin like 1 Gene [Source:MGI Symbol;Acc:MGI:1919094]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24509 Nonsense Available for shipment Available now
sa37897 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa24509
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019350 Nonsense 350 567 9 13
ENSDART00000122997 Nonsense 351 568 9 14
ENSDART00000126395 Nonsense 350 437 9 12

The following transcripts of ENSDARG00000033965 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 25631654)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 24878532
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTTAGTAATTGATGGCACTAATGTGCACTCCATCTTTCCTTCCAGCTA[T/A]TTCCGGGCACTAGTGGAGCAGTTTGAGGTGCAGTTACAGCAGTACCGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37897
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019350 Essential Splice Site 484 567 None 13
ENSDART00000122997 Essential Splice Site 485 568 None 14
ENSDART00000126395   None 437 None 12

The following transcripts of ENSDARG00000033965 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 25627840)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 24874718
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGTAGCCATGGCTGCCACTCTCACTCAGCAGCAGCAGCCGGCTCCAGG[T/C]CTGACCGCCTTCAAGTTCTAGACCTCTTGACTGATAGATATAAGGAATAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link