entpd2a.2

Ensembl ID:
ENSDARG00000033953
ZFIN ID:
ZDB-GENE-040724-67
Description:
Novel protein similar to human ectonucleoside triphosphate diphosphohydrolase 2 (ENTPD2) [Source:Uni
Human Orthologue:
ENTPD2
Human Description:
ectonucleoside triphosphate diphosphohydrolase 2 [Source:HGNC Symbol;Acc:3364]
Mouse Orthologue:
Entpd2
Mouse Description:
ectonucleoside triphosphate diphosphohydrolase 2 Gene [Source:MGI Symbol;Acc:MGI:1096863]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38478 Essential Splice Site Mutation detected in F1 DNA During 2016
sa10744 Nonsense Available for shipment Available now
sa38477 Nonsense Mutation detected in F1 DNA During 2016
sa17661 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa38478
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043259 Essential Splice Site 37 454 2 9
Genomic Location (Zv9):
Chromosome 5 (position 31207298)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28968655
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAATCCAAGACAAGTTTGTGGAAAATGTTAACAGATGTGTTTGTCTCCA[G/A]TATGGAATAGTTCTGGATGCTGGATCCTCTCATACGTCCATGTTTATCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10744
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043259 Nonsense 353 454 7 9
Genomic Location (Zv9):
Chromosome 5 (position 31204582)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28965939
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNNTATCTCTTTCTTTGGCACAGGCATTTTCTGCATTTTATTACATTCAT[C/T]AATTCTTGCAAAAAGCTGCAGGCATCACCATCACGTCTCCAGCGGATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38477
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043259 Nonsense 428 454 8 9
Genomic Location (Zv9):
Chromosome 5 (position 31202468)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28963825
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGATATGGTTTCAGTGATCTCTCCTTTCCACACATCTCCTTTCAGGAA[A/T]AAGTAAGACACTCAGAAAGACCACTATGCAGTTTTAAGACATATCCTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17661
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043259 Essential Splice Site 428 454 8 9
Genomic Location (Zv9):
Chromosome 5 (position 31202465)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28963822
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATATGGTTTYAGTGATCTCTCCTTTCCACACATCTCCTTTCAGGAAAAA[G/A]TAAGACACTCAGAAAGACCACTATRCAGTTTTAAGACATATCCTGTCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link