entpd2a.2

Ensembl ID:
ENSDARG00000033953
ZFIN ID:
ZDB-GENE-040724-67
Description:
Novel protein similar to human ectonucleoside triphosphate diphosphohydrolase 2 (ENTPD2) [Source:Uni
Human Orthologue:
ENTPD2
Human Description:
ectonucleoside triphosphate diphosphohydrolase 2 [Source:HGNC Symbol;Acc:3364]
Mouse Orthologue:
Entpd2
Mouse Description:
ectonucleoside triphosphate diphosphohydrolase 2 Gene [Source:MGI Symbol;Acc:MGI:1096863]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10744 Nonsense Available for shipment Available now
sa17661 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10744
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043259 Nonsense 353 454 7 9
Genomic Location:
Chromosome 5 (position 31204582)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNNTATCTCTTTCTTTGGCACAGGCATTTTCTGCATTTTATTACATTCAT[C/T]AATTCTTGCAAAAAGCTGCAGGCATCACCATCACGTCTCCAGCGGATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17661
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043259 Essential Splice Site 428 454 8 9
Genomic Location:
Chromosome 5 (position 31202465)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATATGGTTTYAGTGATCTCTCCTTTCCACACATCTCCTTTCAGGAAAAA[G/A]TAAGACACTCAGAAAGACCACTATRCAGTTTTAAGACATATCCTGTCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jt1x0yl3