lamb2l

Ensembl ID:
ENSDARG00000033950
ZFIN ID:
ZDB-GENE-030131-4205
Description:
Novel protein similar to vertebrate laminin beta family [Source:UniProtKB/TrEMBL;Acc:B7ZDA7]
Human Orthologues:
LAMB1, LAMB2
Human Descriptions:
laminin, beta 1 [Source:HGNC Symbol;Acc:6486]
laminin, beta 2 (laminin S) [Source:HGNC Symbol;Acc:6487]
Mouse Orthologues:
Lamb1, Lamb2
Mouse Descriptions:
laminin B1 Gene [Source:MGI Symbol;Acc:MGI:96743]
laminin, beta 2 Gene [Source:MGI Symbol;Acc:MGI:99916]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37675 Nonsense Mutation detected in F1 DNA During 2016
sa15326 Essential Splice Site Available for shipment Available now
sa4204 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa37675
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048366 Nonsense 34 627 2 11
ENSDART00000130856 Nonsense 1015 1780 21 32
Genomic Location:
Chromosome 23 (position 20570654)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTCATGCATTTATATTTAACTCTGCTCTCTGTTTCATTCTACAGGATG[T/A]ACTTGTGTAACTGCAGGCACTTTGCCAAACTCTTGCACTGATGGAGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15326
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048366 Essential Splice Site 323 627 6 11
ENSDART00000130856 Essential Splice Site 1304 1780 25 32
Genomic Location:
Chromosome 23 (position 20559369)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TYGTAATAAACATTGAAATGAGGTTGATGTTTTTGCTATTTCCCTTTTAC[A/T]GAGCAATYTGCAAATGTGCTGAAGTATTACCAGAGATCCCTGAATTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4204
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048366 Nonsense 364 627 6 11
ENSDART00000130856 Nonsense 1345 1780 25 32
Genomic Location:
Chromosome 23 (position 20559245)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGGACCCCAGAGTCCTGTGGAACAGTCTCAGGACACACGTAACCGTACC[G/T]AAGCCCTGCTGAAGGACAAGAAGGACAGCCTCCTGCGTACAGCCACAGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • IgG glycosylation: Loci associated with N-glycosylation of human immunoglobulin G show pleiotropy with autoimmune diseases and haematological cancers. (View Study)
  • Ulcerative colitis: Genome-wide association identifies multiple ulcerative colitis susceptibility loci. (View Study)
  • Ulcerative colitis: Genome-wide association study of ulcerative colitis identifies three new susceptibility loci, including the HNF4A region. (View Study)
  • Ulcerative colitis: Ulcerative colitis-risk loci on chromosomes 1p36 and 12q15 found by genome-wide association study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link