lamb2l

Ensembl ID:
ENSDARG00000033950
ZFIN ID:
ZDB-GENE-030131-4205
Description:
Novel protein similar to vertebrate laminin beta family [Source:UniProtKB/TrEMBL;Acc:B7ZDA7]
Human Orthologues:
LAMB1, LAMB2
Human Descriptions:
laminin, beta 1 [Source:HGNC Symbol;Acc:6486]
laminin, beta 2 (laminin S) [Source:HGNC Symbol;Acc:6487]
Mouse Orthologues:
Lamb1, Lamb2
Mouse Descriptions:
laminin B1 Gene [Source:MGI Symbol;Acc:MGI:96743]
laminin, beta 2 Gene [Source:MGI Symbol;Acc:MGI:99916]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15326 Essential Splice Site Available for shipment Available now
sa4204 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15326
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048366 Essential Splice Site 323 627 6 11
ENSDART00000130856 Essential Splice Site 1304 1780 25 32
Genomic Location:
Chromosome 23 (position 20559369)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TYGTAATAAACATTGAAATGAGGTTGATGTTTTTGCTATTTCCCTTTTAC[A/T]GAGCAATYTGCAAATGTGCTGAAGTATTACCAGAGATCCCTGAATTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4204
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048366 Nonsense 364 627 6 11
ENSDART00000130856 Nonsense 1345 1780 25 32
Genomic Location:
Chromosome 23 (position 20559245)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGGACCCCAGAGTCCTGTGGAACAGTCTCAGGACACACGTAACCGTACC[G/T]AAGCCCTGCTGAAGGACAAGAAGGACAGCCTCCTGCGTACAGCCACAGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • IgG glycosylation: Loci associated with N-glycosylation of human immunoglobulin G show pleiotropy with autoimmune diseases and haematological cancers. (View Study)
  • Ulcerative colitis: Genome-wide association identifies multiple ulcerative colitis susceptibility loci. (View Study)
  • Ulcerative colitis: Genome-wide association study of ulcerative colitis identifies three new susceptibility loci, including the HNF4A region. (View Study)
  • Ulcerative colitis: Ulcerative colitis-risk loci on chromosomes 1p36 and 12q15 found by genome-wide association study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nhloeyl3