fbxo16

Ensembl ID:
ENSDARG00000033949
ZFIN ID:
ZDB-GENE-041015-747
Description:
F-box protein 16 [Source:RefSeq peptide;Acc:NP_001121873]
Human Orthologue:
FBXO16
Human Description:
F-box protein 16 [Source:HGNC Symbol;Acc:13618]
Mouse Orthologue:
Fbxo16
Mouse Description:
F-box protein 16 Gene [Source:MGI Symbol;Acc:MGI:1354706]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43493 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43493
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045135 Nonsense 143 356 5 9
Genomic Location (Zv9):
Chromosome 20 (position 35276424)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35348937
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGTCTGAAACTCGGCTGGTGCATAACCTTTACTCCGACACCATTTGAG[C/T]AAGGCGTATGGAAGAGGCAATACATAGAGACAGTACAAGAGCTTCACATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link