LOC100334018

Ensembl ID:
ENSDARG00000033909
Human Orthologue:
SLC29A2
Human Description:
solute carrier family 29 (nucleoside transporters), member 2 [Source:HGNC Symbol;Acc:11004]
Mouse Orthologue:
Slc29a2
Mouse Description:
solute carrier family 29 (nucleoside transporters), member 2 Gene [Source:MGI Symbol;Acc:MGI:1345278

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12227 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12227
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097944 Essential Splice Site 92 257 4 7
Genomic Location:
Chromosome 7 (position 73967991)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTTAAACCTGTAATATGTCCTGTGGTAAACCTKTATTCATTGTCTTCA[G/A]ATCTGGGTGATGGCCTTCTGCGTGACCTTCGTCTTCATYGTTACGCTCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ew0tas5j