msi2a

Ensembl ID:
ENSDARG00000033901
ZFIN ID:
ZDB-GENE-030826-25
Description:
musashi homolog 2a [Source:RefSeq peptide;Acc:NP_997961]
Human Orthologue:
MSI2
Human Description:
musashi homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:18585]
Mouse Orthologue:
Msi2
Mouse Description:
Musashi homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1923876]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12004 Essential Splice Site Available for shipment Available now
sa34961 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa12004
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099473 Essential Splice Site 21 388 None 16
ENSDART00000132096 Essential Splice Site 21 388 None 15

The following transcripts of ENSDARG00000033901 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 38833560)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAGTCAAGTCACCTCTGGAAGCCTGAACGATTCGCAACACGACCCGGGG[T/C]AAGAAGACAGGACGAGTTTGTGTTTGGAGTTTGATTGTGTCCGTGCTCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34961
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099473 Nonsense 182 388 9 16
ENSDART00000132096 Nonsense 182 388 9 15

The following transcripts of ENSDARG00000033901 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 39062366)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGCTTAGCTTTTCTCTTCTTCTCTGTGTGTCTGTCTGCAGGTAGAATG[T/A]AAGAAGGCTCAACCAAAGGAGGTGATGTTTCCTCCAGGCACGAGGGGGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link