ap2m1b

Ensembl ID:
ENSDARG00000033899
ZFIN ID:
ZDB-GENE-040426-1103
Description:
AP-2 complex subunit mu-1-B [Source:UniProtKB/Swiss-Prot;Acc:Q7ZW98]
Human Orthologue:
AP2M1
Human Description:
adaptor-related protein complex 2, mu 1 subunit [Source:HGNC Symbol;Acc:564]
Mouse Orthologue:
Ap2m1
Mouse Description:
adaptor protein complex AP-2, mu1 Gene [Source:MGI Symbol;Acc:MGI:1298405]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa745 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa745
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108636 Splice Site, Nonsense 142 435 5 13
ENSDART00000124051 Splice Site None 436 None 14
Genomic Location:
Chromosome 18 (position 44383412)
KASP Assay ID:
554-0652.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTYTTGGCTGCTCTGTTTTTTCCTCACGCTGCACTCTTATGTTTTTCT[C/T]AGACAAAAGAGGAGCAGTCTCAGATTACCAGTCAGGTCACAGGGCAGATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/85novhpl