csnk1g1

Ensembl ID:
ENSDARG00000033872
ZFIN ID:
ZDB-GENE-041212-63
Description:
Casein kinase I isoform gamma-1 [Source:UniProtKB/Swiss-Prot;Acc:Q5PRD4]
Human Orthologue:
CSNK1G1
Human Description:
casein kinase 1, gamma 1 [Source:HGNC Symbol;Acc:2454]
Mouse Orthologue:
Csnk1g1
Mouse Description:
casein kinase 1, gamma 1 Gene [Source:MGI Symbol;Acc:MGI:2660884]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3623 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3623
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047419 Nonsense 117 421 5 12

The following transcripts of ENSDARG00000033872 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 55184604)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCTCAGGTCTTCTATTTCGGGCCCTGTGGGAAATACAATGCCATGGTTT[T/A]GGAGCTGCTCGGCCCCAGTCTTGAGGATCTCTTTGACCTGTGYGACCGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vddgpqym