derl3

Ensembl ID:
ENSDARG00000033871
ZFIN ID:
ZDB-GENE-040426-1324
Description:
Der1-like domain family, member 3 [Source:RefSeq peptide;Acc:NP_957197]
Human Orthologue:
DERL3
Human Description:
Der1-like domain family, member 3 [Source:HGNC Symbol;Acc:14236]
Mouse Orthologue:
Derl3
Mouse Description:
Der1-like domain family, member 3 Gene [Source:MGI Symbol;Acc:MGI:1917627]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16948 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16948
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043251 Essential Splice Site 108 247 4 7
Genomic Location (Zv9):
Chromosome 8 (position 31771924)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30914650
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAACAGCAGATTTCGTTTACATGTTCCTGTTTGGTGGTGTTCTCATGACC[G/T]TATCCTTCAGAATACACAACATTAAATATCAGTTTAACATCATAATTTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • IgG glycosylation: Loci associated with N-glycosylation of human immunoglobulin G show pleiotropy with autoimmune diseases and haematological cancers. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link