sepsecs

Ensembl ID:
ENSDARG00000033861
ZFIN ID:
ZDB-GENE-040426-859
Description:
O-phosphoseryl-tRNA(Sec) selenium transferase [Source:UniProtKB/Swiss-Prot;Acc:Q803A7]
Human Orthologue:
SEPSECS
Human Description:
Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase [Source:HGNC Symbol;Acc:30605]
Mouse Orthologue:
Sepsecs
Mouse Description:
Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase Gene [Source:MGI Symbol;Acc:MGI:109879

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34255 Essential Splice Site Mutation detected in F1 DNA During 2017
sa16396 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34255
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042492 Essential Splice Site 90 490 3 11
Genomic Location (Zv9):
Chromosome 7 (position 75140050)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 71210927
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAAGCAACTGAGAAAAGCTGTAAATAAATTCTCTGCTAATATCTCCTC[A/G]GGCTGATCCATGGCATCGGTCGGTCGGGTGACATCGCAGCTGTTCAGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16396
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042492 Nonsense 164 490 4 11
Genomic Location (Zv9):
Chromosome 7 (position 75138740)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 71209617
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCACGCTGTGTTTCCTCACGCTCAGACACAGGAGACCAAAAGCAYGTTA[T/G]ATTCTCTGGCCTCGCATTGACCAGAAGTCCTGTTTCAAGTCTATGGTGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link