rqcd1

Ensembl ID:
ENSDARG00000033855
ZFIN ID:
ZDB-GENE-030131-1558
Description:
Cell differentiation protein RCD1 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6NWL4]
Human Orthologue:
RQCD1
Human Description:
RCD1 required for cell differentiation1 homolog (S. pombe) [Source:HGNC Symbol;Acc:10445]
Mouse Orthologue:
Rqcd1
Mouse Description:
rcd1 (required for cell differentiation) homolog 1 (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:192890

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43792 Nonsense Mutation detected in F1 DNA During 2017
sa37457 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43792
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047464 Nonsense 34 298 2 9
ENSDART00000143574 Nonsense 34 298 2 8
Genomic Location (Zv9):
Chromosome 22 (position 12899147)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12735077
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGGGAGAAGATCTACCAGTGGATCAATGAGTTGTCCAGTCCAGAAACA[C/T]GAGAGAACGCCCTGCTGGAGCTCAGCAAGAAGAGAGAGTCTGTGACTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37457
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047464 Nonsense 237 298 7 9
ENSDART00000143574 Nonsense 237 298 7 8
Genomic Location (Zv9):
Chromosome 22 (position 12893410)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12729340
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAAGGAACCCTCGGCTCGTCTGCTTAAACATGTTGTGCGCTGTTATTTA[C/T]GACTTTCTGACAACTCCAGGTATTTTTATACGGTTTGCATGAATTTTACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link