mad1l1

Ensembl ID:
ENSDARG00000033852
ZFIN ID:
ZDB-GENE-040426-1081
Description:
mitotic spindle assembly checkpoint protein MAD1 [Source:RefSeq peptide;Acc:NP_957206]
Human Orthologue:
MAD1L1
Human Description:
MAD1 mitotic arrest deficient-like 1 (yeast) [Source:HGNC Symbol;Acc:6762]
Mouse Orthologue:
Mad1l1
Mouse Description:
mitotic arrest deficient 1-like 1 Gene [Source:MGI Symbol;Acc:MGI:1341857]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19431 Nonsense Mutation detected in F1 DNA During 2016
sa14241 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19431
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048610 Nonsense 374 717 10 17
ENSDART00000103478   None 323 None 9
ENSDART00000103479   None 323 None 9
ENSDART00000147904 Nonsense 374 717 11 18

The following transcripts of ENSDARG00000033852 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 8897163)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 9136968
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTCGCTCTGTGGAAAAGGCCCGCTCTGAGCTCCTGACCGAGATTGCT[C/T]AGCTGCGCGCCAAGGCTCAAGAAGAACAGAAGAAACGAGAGAACCAGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14241
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048610 Nonsense 568 717 15 17
ENSDART00000103478 Nonsense 174 323 7 9
ENSDART00000103479 Nonsense 174 323 7 9
ENSDART00000147904 Nonsense 568 717 16 18

The following transcripts of ENSDARG00000033852 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 8869337)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 9109142
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGCAAAGCAGCAGCGRGCGGATGAGGTGGAGCAGCTCAGGGTGGAGTG[T/A]CAGCGTTTGAGGGACCGACTCCGCAAAATCGARRTGGCTGGTGGCATGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)
  • Longevity: Joint influence of small-effect genetic variants on human longevity. (View Study)
  • Schizophrenia: Genome-wide association study in a Swedish population yields support for greater CNV and MHC involvement in schizophrenia compared with bipolar disorder. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link